Detection and Genetic Characteristics of Bovine leukaemia virus in Holstein Cows in China
Lixia Wang1,
Chengcheng Ning1, Chunhui Ji1, Yun Guo1, Na Li1,
Jun Qiao1, Qingling Meng1*, YanRen1*, Xianzhu
Xia1, Xingxing Zhang2, Yucheng Liu2, Kuojun
Cai3, Zaichao Zhang4, Jinsheng Zhang5, Yelong
Peng6 and Xuepeng Cai7
1College of Animal Science and Technology, Shihezi
University, Shihezi, Xinjiang, 832003, China
2Institute of Animal Science and Veterinary
Research, Xinjiang Academy of Agricultural and Reclamation Science, Shihezi,
Xinjiang, 832003, China
3Animal Disease Control and Diagnosis Center,
Urumqi, Xinjiang, 830063, China
4Animal Disease Control and Diagnosis Center,
Changji, Xinjiang, 831100, China
5Center for Animal Disease Prevention and Control,
Tacheng, Xinjiang, 834700, China
6Center for Animal Disease Prevention and Control,
Aksu, Xinjiang, 8430000, China
7State Key Lab of Veterinary Etiological Biology,
Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural
Sciences, Lanzhou, Gansu, 730046, China
*For correspondence: xjmqlqj@sina.com; 2483023427@qq.com
Received 27 June 2020; Accepted 26 September 2020;
Published 10 December 2020
Abstract
Bovine leukosis (BL) is a chronic
tumor disease of dairy cow caused by Bovine
leukemia virus (BLV), which seriously harms the healthy development of
dairy farming. In order to understand the prevalence of BLV in Holstein cows in
Xinjiang, China, serological survey was conducted on 462 clinical serum samples
of Holstein cows collected from 5 large-scale dairy farms during the period of
2015–2018. Molecular detection of BLV env
gene was performed on 109 lymph node samples, and then phylogenetic
relationship was also explored. The results showed that the overall sero-positive
rate of BLV antibody in Holstein cow samples was 8.44% (39/462), while PCR
positive rate was 5.50% (6/109), indicating that BLV infection was emerging in
Holstein cows from large-scale dairy farms in Xinjiang. Compared with other
regional epidemic strains in China and other countries in the world, the
nucleotide and amino acid sequences of env
gene of 6 BLV Xinjiang strains shared 98.9–99.3 and 98.6–99.1% identities,
respectively. Furthermore, a total of 55 mutation sites existed in the nucleotide
sequence of env gene of 6 Xinjiang
strains when compared with JPEH-2 strain from Japan, resulting in 18 mutations
in amino acid residues. Phylogenetic analysis based on env gene showed that three genotypes, namely G1, G6, and G7, were
substantively circulating in Holstein cows, showing significant genetic
heterogeneity in epidemic strains of BLV in China. © 2021 Friends Science
Publishers
Keywords: Bovine leukemia; Bovine leukemia virus; Molecular detection; Genetic heterogeneity; env gene
Introduction
Bovine
leukosis (BL), also known as endemic bovine leukemia, is a chronic tumor
disease of cattle (cows) caused by Bovine
leukemia virus (BLV), which is characterized by malignant proliferation of
lymphoid cells, progressive cachexia, and enlarged lymph nodes, reduced milk
production and high mortality after onset (Norby et al. 2016; Yang et al.
2016a). Since BL was firstly reported in 1878, this disease was subsequently
discovered in many countries, including the United States, Japan, Brazil,
Argentina, Thailand and South Korea (Gutiérrez et al. 2011; Rola-Łuszczak et
al. 2013; Lee et al. 2015, 2016).
Nowadays, this infectious disease has widely spread to almost all
cattle-raising countries in the world (Khudhair et al.
2016; Pandey et al. 2017), which has
posed great threats to dairy industry. In 1974, BLV was first detected in
China, and subsequently in more than 10 provinces across the country one after
another. At present, BL has been classified as a second-class infectious
disease in dairy cows in China.
BLV belongs to the single-stranded RNA virus of subfamily oretroviridae within family Oncoviridae, which is prone to rapid
mutation (Camargos et al. 2014; Polat et al. 2015; Ochirkhuu et al.
2016). The genome of BLV is 8714 nucleotides in length and contains a long
terminal sequence (LTR) at each end of its genome (Hirsch et al. 2015). The BLV genome from the 5' end to the 3' end is the
structural group-specific antigen gene (gag),
polymerase gene (pol), envelope gene
(env) and the consensus sequence (U3) (Rovnak and Casey 1999),
respectively. Among them, env gene
encodes the two glycoproteins, gp51 and gp30 (Marawan et al. 2017), respectively. As one of main structural proteins,
Gp51 glycoprotein is located on the BLV capsule, which can induce the specific
antibodies (Bruck et al. 1982, 1984)
and is prone to variability under immune pressure. Initially, BLV epidemic
strains in different regions could be divided into 7 genotypes (G1–G7) based on
env gene (Yang et al. 2016b). Subsequently, the eighth genotype (G8) was
identified and then two more new genotypes, G9 and G10, in Bolivia, Thailand
and Myanmar, were found (Polat et al.
2016). To date, at least 10 BLV genotypes (G1–G10) have been identified (Polat et al. 2017).
Xinjiang is one of China's most important dairy breeding bases, with a
current dairy population of 3.6 million heads. In the recent years, Xinjiang
has vigorously developed large-scale dairy farming through importing large
number of Holstein cows and its’ frozen semen from abroad and inland provinces
of China. Unfortunately, with the large-scale introduction of dairy cows,
transboundary infectious diseases have also been emerging, causing huge
economic losses to the dairy farming industry. However, at the present, the
infection status and molecular characteristics of BLV in Xinjiang are practically
unclear. Thus, the main purposes of this study were to investigate the
seroprevalence and genetic characteristics of BLV strains in large-scale dairy
farms in Xinjiang China, for providing useful molecular epidemiological data
for prevention and control of BLV infection in dairy cows.
Materials and Methods
Collection of samples
During the period of 2015–2018, a
total of 462 clinical serum samples of Holstein dairy cows from 4 to 8 years
old cows and 109 lymph node samples from dead Holstein cows were collected from
5 large-scale dairy farms in five different geographic farms of Xinjiang (Yili,
Shihezi, Urumqi, Changji, and Aksu). The collected samples were placed in an
ice box and transported at low temperature to Xinjiang Key Laboratory of Animal
Disease Control and Prevention.
Serological testing
According to the instructions of
the BLV ELISA antibody detection kit (IDEXX Leukosis Serum X2, Switzerland), a
total of 462 Holstein dairy cow clinical serum samples were tested for BLV
antibodies, and the test results of different dairy farms were statistically
analyzed.
Design of primers
The genome sequences of different
geographical strains of BLV in GenBank were compared, and the conserved
sequence in the BLV LTR region was selected for the design of specific primers. The nested PCR primers FP1-RP1 (outer
primers) and FP2-RP2 (inner primers) were designed to detect BLV proviral DNA
(Table 1). The conserved sequence of env
gene was selected to design the primer FP3-RP3 (Table 1). Theses primer sequences
were sent to The Beijing Genomics Institute for synthesis (BGI, China).
Molecular detection
The lymph node samples of the dead
cows were taken out and used for the molecular detection. Briefly, the sample
was ground with a test tube mill and DNA was extracted with a DNA extraction
kit (Qiagen, Germany). Using the extracted DNA as
a template, the nested PCR amplification was performed with the primers
OFP1-ORP1 (outer primer) and IFP2-IRP2 (inner primer), respectively. PCR
reaction system was consisted of the following reagents: 2.0 μL of
10×buffer (containing MgCl2), 0.6 μL of 2.5 mmol/L dNTP,
0.4 μL of 20 mM OFP1 and ORP1 primers, 1.0 μL of
DNA template, 0.5 μL of TaqDNA (2.5 U/mL) polymerase (TaKaRa Bio, Japan), and the final volume was made up to 20 μL
with H2O. The reaction conditions were set as follows:
pre-denaturation at 94℃ for 10 min, denaturation at 94℃ for 1.5
min, annealing at 50℃ for 1.5 min, extension at 72℃ for 1.5
min, a total of 30 cycles, followed by final extension at 72℃ for 5 min.
After the first PCR amplification, 1.0 μL
of the amplified product was taken, and IFP2-IRP2 was used to perform the
second PCR amplification in the same reaction system. The PCR products were
separated by electrophoresis on a 1.5% agarose gel, and then visualized under a
UV lamp.
Cloning and sequencing of env
gene of BLV epidemic strain
Briefly, PCR amplification of env gene fragment of provirus was
performed on BLV nucleic acid positive samples with FP3-RP3 Primers. The
amplified PCR product was purified and recovered using DNA recovery kit
(TaKaRa, Japan). The recovered target fragment was cloned into the pMD18-T
vector (TaKaRa, Japan), and the positive clones were selected by PCR method and
sent to Shanghai Biotechnology Co., Ltd. for sequencing (Sangon, China). Three
positive clones were selected from each sample, and each clone was sequenced
three times.
Analysis of variation and genetic characteristics
of env gene of BLV
The sequence completely consistent
with the three sequencing results was taken as the target gene sequence. The env genes of different genotypes in
different regions of BLV were downloaded from GenBank. DNAStar7.1 (DNASTAR Inc., USA) and Clustal X 2.1 software (http://www.clustal.org/) were applied to compare the nucleotide sequence
of env gene of BLV epidemic strain in
Xinjiang with the reported BLV epidemic strains in different regions, and
genetic variations of key sites such as A-G antigenic sites, CD4+ T
cell epitopes, CD8+ T cell epitopes, and ND1-ND3 domain segments
were analyzed. The polygenetic tree was constructed using Mega 6.0 software (https://www.megasoftware.net/), and the genetic evolution
relationships among epidemic strains in different regions were explored.
Statistical analysis of data
S.P.S.S. 18 software (Version 18.0,
IBM, U.S.A.) was used for conducting statistical analysis. Chi-square test was
used to compare the sero-positive rates of different farms. The difference with
P < 0.05 was considered
statistically significant, while P
< 0.01 was considered extremely significant.
Results
The seroprevalence rates of
Holstein cows in various large-scale dairy farms in Xinjiang ranged from 5.15
to 16.16%, respectively, with the overall seropositivity being 8.44% (39/462)
(Table 2). Among 109 lymph node disease materials tested, 6 positive samples
were detected, and the PCR positive rate was 5.50% (6/109) (Fig. 1,
Supplementary Fig. 1), indicating that BLV infection was prevalent in dairy
farms in Xinjiang.
Env gene fragments were amplified from
6 PCR-positive samples (Fig. 2) and these sequences were submitted to Genbank
(GenBank accession numbers: BLV-XJ-4, MN765152; BLV-XJ-26, MN765153; BLV-XJ-65,
MN765154; BLV-XJ-87, MN765155; BLV-XJ-91, MN765156; BLV-XJ-102, MN765157)
(Supplementary Table 1). The nucleotide sequences of env gene of 6 BLV Xinjiang epidemic strains shared 99.1–99.8%
identities, while they shared 96.2–99.6% identities when compared with other
BLV strains in the world.
Among the
BLV epidemic strains in different regions, env
gene has a total of 73 nucleotide mutation sites, and the encoded gp51 protein amino acid sequence has 21
mutation sites. Compared with JPEH-2 strain from Japan, a total of 55 mutation
sites were identified in the nucleotide sequence of env gene of 6 Xinjiang strains, which caused 18 mutations in the
amino acid residues of gp51 protein (Supplementary Fig. 2). Most importantly,
the ND2 domain of BLV-XJ-65 and BLV-XJ-91 strain were substantively altered;
the CD8+ epitope of BLV-XJ-26, BLV-XJ-65, BLV-XJ-87, BLV-XJ-91,
BLV-XJ-102 strains were also genetically mutated when compared with JPEH-2
strain from Japan.
Phylogenetic
analysis based on env gene showed
that the different geographical strains of BLV could be divided into 10
genotypes (G1–G10), and different genotypes include epidemic strains in different regions (Fig. 3).
Table 1: Primers used in this study
Primer’s name |
Nucleotide sequence (5’ to 3’) |
Position in reference sequence |
Size of amplified product (bp) |
OFP1 |
CCTAGGAAACCAACAATGGATG |
116-137 |
640 |
ORP1 |
CGTGTTGACCCAGAAGATTTGG |
734-755 |
|
IFP2 |
TCACCTTTCTGTGCCAAGTCTC |
204-235 |
321 |
IRP2 |
CTTATGTAAAGAAAAGGTGATC |
503-524 |
|
FR3 |
ATGCCTAAAGAACGACGGTCCCGAA |
1-25 |
897 |
RR3 |
GACCCGGGTAGGAGGGGCGGAGGA |
873-897 |
Table 2: Serological detection results of BLV infection by
indirect ELISA in five different geographic farms in China
Farm |
Number of samples |
Number of positive samples |
Positive rate (%) of BLV |
Farm 1 |
91 |
7 |
7.69 (7/91) a |
Farm 2 |
85 |
6 |
7.06 (6/85) a |
Farm 3 |
97 |
5 |
5.15 (5/97) a |
Farm 4 |
99 |
16 |
16.16 (16/99) b |
Farm 5 |
90 |
5 |
5.56 (5/90) a |
Total |
462 |
39 |
8.44 (39/462) |
Note: Different superscript
letters in one column means significant difference (P < 0.05)
Fig. 1: Molecular detection of provirus
DNA of BLV in lymph node from Holstein cows in
Xinjiang China by nested PCR
M:DNA marker standard DL-2000(2000,1000,750,500,250,100
bp);1-3:positive
samples
Fig. 2: Amplification of env gene of different strains of BLV
from positive samples
M: DNA marker standard DL-1000 (1000, 750, 600, 500,
200, 100 bp);
1-3:
Amplification of env gene from
positive samples
Among the 6 BLV epidemic strains in Xinjiang,
BLV-XJ-4, BLV-XJ-26, BLV-XJ-91
and BLV-XJ-102 strain belong to
Fig. 3: Phylogenetic
analysis of different geographical strains of BLV based on the nucleotide
sequences of env genes
Phylogenetic tree based on the nucleotide sequences of env genes was constructed by the
neighbor-joining methods using 1000 bootstrap replicate values. These env genes were obtained in this study
and available in GenBank (Supplemental Table 1). Different genotypes were
indicated by vertical lines. The black dot represents the different strains of
BLV identified in this study. The GenBank accession numbers of BLV env genes of different geographical
strains in Xinjiang China were as
follows: BLV-XJ-4, MN765152; BLV-XJ-26, MN765153; BLV-XJ-65, MN765154;
BLV-XJ-87, MN765155; BLV-XJ-91,
MN765156; BLV-XJ-102, MN765157
G1, while
BLV-XJ-65 strain belongs to G6, and BLV-XJ-87 strain belongs to G7, which
indicated that significant genetic heterogeneity had occurred in epidemic
strains of BLV in China.
Discussion
In the recent years, BLV infection
has been widespread in many countries around the world, which has brought
greater harm to dairy farming (Gutiérrez et
al. 2011; Merlini et al. 2016; Norby
et al. 2016; Ruiz et al. 2018). However, infection status
and molecular characteristics of BLV in Holstein dairy cows in Xinjiang China
still remain unclear. In 2014, BLV infection in Yaks (Bos mutus) in China was firstly reported (Ma et al. 2016). Recently, an epidemiological survey on yaks on the
Qinghai-Tibet Plateau in China showed that the seropositivity rates were in the
range between 14.94 and 18.93% (Wang et
al. 2018). In this study, the overall seropositivity rate was 15.6–27.9% in
5 large-scale dairy farms, which suggested that BLV infection in Xinjiang is
relatively common.
According
to the identities of env gene
sequences, BLV epidemic strains in different geographical regions of the world
can be divided into at least ten genotypes, G1 to G10 (Polat et al. 2016, 2017). Confirmed that there
were at least two genotypes, G6 and G10, in the yak epidemic strain in Tibet,
China (Wang et al. 2018). In this
study, three genotypes, G1, G6 and G7 were identified for the first time in
Xinjiang, of which G1 is the dominant genotype in Holstein cows.
Gp51
glycoprotein protein encoded by env
gene is located on the capsule of BLV, which is one of the main antigenic
proteins and extremely susceptible to mutation (Bruck et al. 1982, 1984; Balić et
al. 2012; Camargos et al. 2014; Pluta
et al. 2017). It has been found that
BLV gp51 glycoprotein contains three neutralization domains of ND1, ND2, and
ND3 and five T cell epitopes (CD4+ T cell epitope, CD8+ T
cell epitope, gp51N5, gp51N11, and gp51N12) (Bruck et al. 1982). However, the alterations of the ND2 domains in
BLV-XJ-65 and BLV-XJ-91 strain and the CD8+ epitopes of BLV-XJ-26,
BLV-XJ-65, BLV-XJ-87, BLV-XJ-91, BLV-XJ-102 strain maybe affect the interaction
between gp51 protein with the receptor on host cells, which will likely alter
the pathogenicity and antigenicity of virus. Therefore, the impacts of genetic
variations in key sites on infection and immune escape of BLV need to be
further investigated (Lee et al.
2015; Brogniez et al. 2016).
It is
currently believed that BLV can be transmitted horizontally and vertically
(Gutiérrez et al. 2011). Transmission
routes of BLV include contact transmission, secretory transmission (oral and
nasal secretions, milk, urine, feces and semen), blood-borne transmission
(virus-contaminated devices, injections and blood collection), artificial
fertilization and embryo transfer (Mekata et
al. 2015). Notably, one of the five geographic dairy farms investigated in
this study owned a significantly higher infection rate than those of the other
dairy farms, which may be related to the repeated use of syringes and needles
during blood collection or tuberculin intradermal tests (epidemiological
survey). Therefore, blood-borne transmission should be received more attention
for the dairy farm breeders and veterinarians. In addition, regular serological
and molecular detection to monitor the infected cattle is of high importance
for the prevention and control of BLV infection in dairy farms.
Conclusion
This study for the first time
confirmed that three genotypes of BLV, namely G1, G6, and G7, were
substantively circulating in Holstein cows, showing significant genetic
heterogeneity in BLV Xinjiang strains, which provided useful epidemiological
data for the prevention and control of BLV infection in dairy cows.
Acknowledgments
The authors thank the field staff for providing the
samples for this study. This work was supported by grant from the national key
research and development program (No. 2016YFD0500900), International Science
& Technology Cooperation Program of XPCC (No. 2019BC004), and International
Science & Technology Cooperation Program of China (No. 2014DFR31310).
Authors’ contributions
Lixia Wang, Jun Qiao, Qingling Meng
and YanRen planned and designed the whole study. Chengcheng Ning and chunhui Ji
carried out the whole work. Xingxing Zhang, Yucheng Liu, Kuojun Cai, Zaichao
Zhang, Jinsheng Zhang and Yelong Peng collected sample. Lixia Wang, Jun Qiao
and Qingling Meng wrote the manuscript. Yun Guo, Na Li, Xianzhu Xia and Xuepeng
Cai helped during manuscript writing and revision. All authors read and
approved the final manuscript.
References
Balić
D, I Lojkić, M Periškić, T Bedeković, A Jungić, N Lemo, B
Roić, Z Cač, L Barbić, J Madić (2012). Identification of a new
genotype of Bovine leukemia virus. Arch Virol 157:1281‒1290
Brogniez
AD, J Mast, L Willems (2016). Determinants of the Bovine leukemia virus envelope glycoproteins involved in
infectivity, replication and pathogenesis. Viruses
8; Article 88
Bruck
C, D Portetelle, M Mammerickx, S Mathot, A Burny (1984). Epitopes of Bovine leukemia virus glycoprotein gp51
recognized by sera of infected cattle and sheep. Leuk Res 8:315‒321
Bruck
C, S Mathot, D Portetelle, C Berte, JD Franssen, P Herion, A Burny (1982). Monoclonal
antibodies define eight independent antigenic regions on the bovine leukemia virus (BLV) envelope
glycoprotein gp51. Virology 122:342‒352
Camargos
MF, DS Rajão, RC Leite, D Stancek, MB Heinemann, JK Reis (2014). Genetic
variation of Bovine leukemia virus (BLV)
after replication in cell culture and experimental animals. Genet Mol Res 13:1717‒1723
Gutiérrez
G, I Alvarez, R Politzki, M Lomónaco, MJ Dus Santos, F Rondelli, N Fondevila, K
Trono (2011). Natural progression of Bovine
leukemia virus infection in Argentinean dairy cattle. Vet Microbiol 151:255‒263
Hirsch
C, MF Camargos, EF Barbosa-Stancioli, AAF Júnior, DS Rajão, MB Heinemann, JK
Reis, RC Leite (2015). Genetic variability and phylogeny of the 5' long
terminal repeat from Brazilian Bovine
leukemia virus. Genet Mol Res
14:14530‒14538
Khudhair
YI, SA Hasso, NY Yaseen, AM Al-Shammari (2016). Serological and molecular
detection of Bovine leukemia virus in
cattle in Iraq. Emerg Microb Infect 5;
Article e56
Lee
E, EJ Kim, J Ratthanophart, R Vitoonpong, BH Kim, IS Cho, JY Song, KK Lee, YK
Shin (2016). Molecular epidemiological and serological studies of Bovine leukemia virus (BLV) infection in
Thailand cattle. Infect Genet Evol
41:245‒254
Lee
E, EJ Kim, HK Joung, BH Kim, JY Song, IS Cho, KK Lee, YK Shin (2015).
Sequencing and phylogenetic analysis of the gp51 gene from Korean Bovine leukemia virus isolates. Virol J 12; Article 64
Ma
JG, WB Zheng, DH Zhou, SY Qin, MY Yin, XQ Zhu, GX Hu (2016). First report of Bovine leukemia virus infection in yaks
(Bos mutus) in China. Biomed Res Intl 2016; Article 9170167
Marawan
MA, H Mekata, T Hayashi, S Sekiguchi, Y Kirino, Y Horii, AM Moustafa, FK
Arnaout, ESM Galila, J Norimine (2017). Phylogenetic analysis of env gene of Bovine leukemia virus strains spread in Miyazaki prefecture, Japan.
J Vet Med Sci 79:912‒916
Mekata
H, S Sekiguchi, S Konnai, Y Kirino, K Honkawa, N Nonaka, Y Horii, J Norimine
(2015). Evaluation of the natural perinatal transmission of Bovine leukaemia virus. Vet Rec 176:254
Merlini
R, G Gutiérrez, I Alvarez, JP Jaworski, H Carignano, M Poli, L Willems, K Trono
(2016). Bovine leukemia virus becomes
established in dairy herds before the first lactation. Arch Virol 161:3215‒3217
Norby B, PC Bartlett, TM Byrem,
RJ Erskine (2016). Effect of
infection with Bovine leukemia virus
on milk production in Michigan dairy cows. J
Dairy Sci 99:2043‒2052
Ochirkhuu
N, S Konnai, R Odbileg, A Nishimori, T Okagawa, S Murata, K Ohashi (2016).
Detection of Bovine leukemia virus
and identification of its genotype in Mongolian cattle. Arch Virol 16:985‒991
Pandey
GS, E Simulundu, D Mwiinga, KL Samui, AS Mweene, M Kajihara, A Mangani, R
Mwenda, J Ndebe, S Konnai, A Takada (2017). Clinical and subclinical Bovine leukemia virus infection in a
dairy cattle herd in Zambia. Arch Virol
162:1051‒1056
Pluta
A, M Rola-Łuszczak, P Kubiś, S Balov, R Moskalik, B Choudhury, J
Kuźmak (2017). Molecular characterization of Bovine leukemia virus from Moldovan dairy cattle. Arch Virol 162:1563‒1576
Polat
M, HH Moe, T Shimogiri, KK Moe, SN Takeshima, Y Aida (2017). The molecular
epidemiological study of Bovine leukemia
virus infection in Myanmar cattle. Arch
Virol 162:425‒437
Polat
M, SN Takeshima, K Hosomichi, J Kim, T Miyasaka, K Yamada, M Arainga, T
Murakami, Y Matsumoto, VDLB Diaz, CJ Panei, ET González, M Kanemaki, M Onuma, G
Giovambattista, Y Aida (2016). A new genotype of Bovine leukemia virus in South America identified by NGS-based
whole genome sequencing and molecular evolutionary genetic analysis. Retrovirology 13; Article 4
Polat
M, A Ohno, SN Takeshima, J Kim, M Kikuya, Y Matsumoto, CN Mingala, M Onuma, Y
Aida (2015). Detection and molecular characterization of Bovine leukemia virus in Philippine cattle. Arch Virol 160:285‒296
Rola-Łuszczak
M, A Pluta, M Olech, I Donnik, M Petropavlovskiy, A Gerilovych, I Vinogradova,
B Choudhury, J Kuźmak (2013). The molecular characterization of Bovine leukaemia virus isolates from
Eastern Europe and Siberia and its impact on phylogeny. PLoS One 8; Article e58705
Rovnak
J, JW Casey (1999). Assessment of Bovine
leukemia virus transcripts in vivo.
J Virol 73:8890‒8897
Ruiz
V, NG Porta, M Lomónaco, K Trono, I Alvarez (2018). Bovine leukemia virus Infection in neonatal calves. Risk Factors
and Control Measures. Front Vet Sci
5; Article 267
Wang
M, Y Wang, AR Baloch, Y Pan, F Xu, L Tian, Q Zeng (2018). Molecular
epidemiology and characterization of Bovine
leukemia virus in domestic yaks (Bos
grunniens) on the Qinghai-Tibet Plateau, China. Arch Virol 163:659‒670
Yang
Y, W Fan, Y Mao, Z Yang, G Lu, R Zhang, H Zhang, C Szeto, C Wang (2016a). Bovine leukemia virus infection in
cattle of China: Association with reduced milk production and increased somatic
cell score. J Dairy Sci 99:3688‒3697
Yang Y, PJ
Kelly, J Bai, R Zhang, C Wang (2016b). First molecular characterization of Bovine leukemia virus infections in the
Caribbean. PLoS One 11; Article e0168379